 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0001649 | |||
| Gene | SHPRH | Organism | Human |
| Genome Locus | chr6:146209155-146216113:- | Build | hg19 |
| Disease | Cholangiocarcinoma | ICD-10 | Intrahepatic bile duct carcinoma (C22.1) |
| DBLink | Link to database | PMID | 29337065 |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | HCCC-9810 and RBE cell lines,CCA cells including CCLP1, HuCCT1, Huh-28, KMBC and QBC939 and human intrahepatic biliary epithelial cell (HIBEC) and CCA cancer tissues and non-cancerous tissues |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward AATGCTGAAAACTGCTGAGAGAA ReverseTTGAGAAAACGAGTGCTTTGG | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
| Citation | |||
| Xu, Y, Yao, Y, Zhong, X, Leng, K, Qin, W, Qu, L, Cui, Y, Jiang, X (2018). Downregulated circular RNA hsa_circ_0001649 regulates proliferation, migration and invasion in cholangiocarcinoma cells. Biochem. Biophys. Res. Commun., 496, 2:455-461. | |||